The amelioration effect of sesamoside on inflammatory response in septic shock

Abstract

Sepsis shock is caused by a systemic infection characterized by circulatory disorders and metabolic abnormalities. Microorganisms or their toxins enter the bloodstream, releasing inflammatory mediators and triggering systemic inflammatory reactions, leading to multiple organ dysfunction and even failure. To explore new treatment methods, we studied the improvement effect of sesamoside on the inflammatory response in septic shock. We performed in vitro experiments and animal models. We found that sesamoside reduced inflammatory cytokines such as TNF-α, IL-6, IL-1β, iNOS, and NO. Sesamoside inhibited the LPS-induced phosphorylation of ERK and JNK and downregulated the expression of NLRP3, reducing the systemic inflammatory response. In addition, sesamoside reduces multi-organ injuries in LPS-induced septic shock and restricts the nuclear localization of P65 to regulate the immune response, enhance immune function, and help restore cell metabolism and organ function. This study reveals the improved effect of sesamoside on inflammatory response in septic shock, providing new ideas and methods for treating septic shock. Future research will explore the mechanism of action of sesamoside and its clinical application value in the treatment of septic shock.

Clinical trial number: Not applicable.

Introduction

Sepsis causes over 11 million deaths worldwide each year; septic shock is the most severe form, with nearly 40% of patients dying upon discharge [1, 2]. The pathophysiology of sepsis is complex, and host susceptibility factors (e.g., age, environment, genetics) interact with pathogen load, virulence, and various pathogen-associated molecular patterns [3]. Endotoxins, also known as lipopolysaccharides (LPS), a major component of the outer membrane of the cell wall of gram-negative bacteria, are effective mediators of the inflammatory cascade and can progress to sepsis and septic shock and have been a targeted treatment for sepsis for decades [4].

Infection of pathogens can cause immune system disorders, and activation of macrophages by LPS can lead to the excessive secretion of M1-type inflammatory factors such as interleukin-6 (IL-6), IL-1β and tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (iNOS) and nitric oxide (NO), increases inflammation of target organs in the body, frequent fever, multiple organ dysfunction, vascular damage, and brain damage in patients [5]. The toll-like receptor 4 (TLR4) can induce M1 polarization in macrophages when infected with pathogens such as bacteria, viruses, fungi, and parasites, leading to pro-inflammatory responses [6]. In the presence of many plasma membrane-anchored CD14, TLR4 is activated by LPS. It controls subsequent activation, which is crucial in transducing endotoxin shock mechanisms [7], and sequentially triggers two signal cascades: myeloid differentiation factor 88 (MyD88) dependency and proline-rich vinculin and TIR domain-containing protein B (TRIF) dependency [8].

TLR4-bound TIRAP recruits MyD88 and binds to inflammatory cytokine receptors, forming a submembrane signaling complex of myddosome [9]. The complex myddosome triggers a signaling cascade by recruiting the E3 ubiquitin ligase TRAF6 while also triggering a signaling cascade reaction with TAK1 kinase and through phosphorylation and activation of IκB kinase α/β (IKKα/β) and activation of c-Jun terminal kinase (JNK) of mitogen-activated protein kinase (MAPK) pathway, the nuclear translocation of NF-κB transcription factor P65 was achieved [10]. TRIF induces the late activation of NF-κB by recruiting and activating TRAF6, thus activating non-classical IKK and ERK protein kinases, and producing cytokines in response to LPS stimulation [11].

Tibetan medicine Phlomoides younghushandii Mukerjee is called “LuMuEr” in Tibetan and is mainly distributed in mountains, meadows, riversides, and shady places in Tibet. It is a traditional Tibetan medicine and has been used for more than 1000 years. The Drug Standards (Tibetan Medicine Volume) of the Ministry of Health of the People’s Republic of China indicate that Phlomoides younghushandii Mukerjee has a bitter taste, a calm nature, and has the effects of dispelling wind and clearing heat, dispersing cold and moistening the throat, relieving cough and phlegm, promoting muscle growth and astringent sores. It treats symptoms such as Bacon’s cold syndrome, pharyngeal scrofula, wind-heat cold, cough and phlegm accumulation, bronchitis, persistent ulcers and ulcers, and lung disease. The preliminary chemical composition test results indicate that it may contain amino acids, proteins, polysaccharides, tannins, phenols, organic acids, flavonoids, coumarins, anthraquinone, triterpenes, steroids, saponins, and other components. At present, the identified compound structures mainly include cyclic ether terpenoid glycosides (sesamoside belongs to this), albumin-type diterpenes, flavonoids, quinones, alkaloids, triterpenes and steroids, sugars and glycosides, fatty acids, and volatile oils [12,13,14].

Sesamoside is a compound from the Phlomoides younghushandii Mukerjee, belonging to a class of cyclic enol ether terpenoids with anti-inflammatory, antibacterial, analgesic, antitussive, expectorant, and asthmatic properties. No research exists on the anti-inflammatory effect and mechanism of sesamoside in LPS-induced septic shock inflammatory response. Therefore, this study aims to investigate the role and related mechanisms of sesamoside in LPS-induced septic shock, providing a basis for expanding the research and development of Tibetan medicine and developing new potential clinical drugs.

Materials and methods

Chemicals and reagents

Sesamoside (Cat# 117479-87-5), LPS (Cat# S11060), dexamethasone(DEX) (Cat# S17003), TritonX-100 (Cat# 9002-93-1), and Ethanol hydrochloride split solution (Cat# R20778) were purchased from Shanghai Yuanye. The nitric oxide assay kit (Cat# A013-2-1) was purchased from Nanjing Jiancheng. ELISA kits (mouse TNF-α (Cat# MM-0132M1), mouse IL-6 (Cat# MM-0163M2), mouse IL-1β (Cat# MM-0040M2)) were purchased from Jiangsu Meimian. Primary antibody (JNK (Cat# D151753-0050), P-JNK (Cat# D151384-0025), ERK (Cat# D151753-0050), P-ERK (Cat# D151384-0025), P65 (Cat# D220135-0025), GAPDH (Cat# D110016-0025)), Trizol reagent (Cat# B610409-0100), ECL reagent (Cat# C520045-0100), Taq-PCR mix (Cat# B639295-0005), and TureColor trichrome pre-staining protein marker (Cat# C510010-0001) were purchased from Shanghai Sangon Biotech. β-actin (Cat# 4970) was purchased from Cell Signaling Technology. NLRP3 primary antibody (Cat# A00034-2), P65 immunohistochemical primary antibody (Cat# A00284-1), CY3 fluorescent antibody (Cat# BA1032), SAB immunohistochemistry kit (Cat# SA1022) were purchased from BioTechnology. DAPI (Cat# CD103), DAB kit (Cat# PC007), Citrate antigen repair solution (Cat# PI002), and HE Staining Solution (Cat# CD002-5) were purchased from Zhonghui Hecai. An apoptosis detection kit (Cat# BB-4101) was purchased from Bestbio.

Cell culture

Mouse Raw264.7 cell (Cat# CBP60533) was purchased from Nanjing Cobioer Biosciences, and was cultured in DMEM medium supplemented with 10% fetal bovine serum with 100 IU/mL penicillin and 100 µg/mL streptomycin, incubated at 37 ℃ with 5% CO₂. Cells were randomly divided into the following groups: blank control group (NC) with PBS, Model group with 1 µg/mL LPS, positive control group with 1 µg/mL LPS + 1 µM DEX [15, 16] sesamoside groups with 1 µg/mL LPS + 25-, 50-, 100-, 200- or 500 µM sesamoside. Sesamoside and DEX were dissolved in PBS. We used PBS as the solvent, which has a well-defined and relatively stable osmotic pressure. During the experiment, we ensured that the osmotic pressure of all media was consistent by strictly controlling the volume and concentration of the added solutions.

Animal treatment

Specific pathogen-free male Kunming mice (8–10 weeks) were obtained from Chengdu Dossy. Mice were maintained on a 12/12 h light/dark cycle with ad libitum access to food and water. Mice were randomly divided into six groups, with six mice in each group: (1) control group with PBS, (2) model group with 10 mg/kg body weight LPS, (3) 10 mg/kg body weight LPS + 10 mg/kg body weight DEX, (4) 10 mg/kg body weight LPS + 1 mg/kg body weight sesamoside, (5) 10 mg/kg body weight LPS + 5 mg/kg body weight sesamoside, (6) 10 mg/kg body weight LPS + 10 mg/kg body weight sesamoside. Mice were intraperitoneally injected with LPS for 12 h, followed by DEX or sesamoside with a concentration gradient for 6 h. At the end of the experiment, the mice were euthanized by cervical dislocation for subsequent analysis. All blood and tissues, such as the heart, liver, spleen, lungs, and kidneys, were collected.

CCK-8 assay

Cell Counting Kit-8 (CCK-8, Cat# E606335) was purchased from Shanghai Sangon Biotech. The cell viability of sesamoside on Raw264.7 was analyzed by CCK-8; cells were seeded in 96-well plates with 100 µl 5 × 10⁵ cells per well for 12 h, and different concentrations of sesamoside was added and incubated for 12 h. After cell treatment, CCK-8 was added and incubated at 37 °C for 1–4 h; the absorbance was measured at 450 nm.

Flow cytometry

The Annexin V-FITC/PI apoptosis detection kit was used. Briefly, cells were treated, collected and washed for re-suspension. Stained with Annexin V-FITC at 4 °C for 15 min and then stained with PI for 5 min, flow cytometry analysis was performed on a flow cytometer (Beckman Gallios) and analyzed using FlowJo software.

NO analysis

The cell supernatant or mice serum was collected, centrifuged, and detected according to the manufacturer’s instructions (Nanjing Jiancheng A013-2-1) as follows: prepare the blank wells using 160 µL of double-distilled water and 80 µL of color developer. Use 160 µL of a 20 µmol/L sodium nitrite standard solution for the standard wells and 80 µL of color developer. The measurement wells were treated with 160 µL of sample supernatant and 80 µL of color developer, respectively, and the absorbance was measured at 550 nm.

Total RNA isolation and qPCR

Total RNA of Raw264.7 cells or mice tissues were extracted with TRIzol reagent, and 1 µg total RNA was reverse-transcribed. qPCR was performed using the QuantStudioTM5 Real-Time PCR instrument (Applied Biosystems) and a reaction mixture consisting of SYBR Green PCR Master Mix, cDNA template, and forward and reverse primers. The sequences of primers used are listed as follows:

Gene	Sequence (5’to 3’)
IL-6	F: CTTCTTGGGGACTGATGCTGGTGAC R: TCTGTTGGGAGTGGTATCCTCTGTG
TNF-α	F: CGCTCTTCTGTCTACTGAACTTCGG R: GTGGTTTGTGAGTGTGAGGGTCTG
IL-1β	F: CACTACAGGCTCCGAGATGAACAAC R: TGTCGTTGCTTGGTTCTCCTTGTAC
iNOS	F: ATCTTGGAGCGAGTTGTGGATTGTC R: TAGGTGAGGGGCTTGGCTGAGTG
NO	F: CGAGAGCACCAGCACCTACC R: ACACAGCGAGAGAGGCGTTCC
β-actin	F: TCTCTTGGCAGCCTTCCTGATTTC R: TGGGGTGGAAAGGTTTGGGAGTATG

Immunofluorescence

Cells were randomly divided into the following groups: blank control group (NC) with PBS; Model group stimulated with LPS for 12 h, followed by the addition of PBS for 24 h; positive control group stimulated with LPS for 12 h, followed by the addition of DEX for 24 h; sesamoside groups timulated with LPS for 12 h, followed by the addition of sesamoside for 6 h, 12 h, and 24 h, respectively. After treatment, cells were fixed with 4% paraformaldehyde for 15 min and permeabilized with 1% Triton X-100 for 10 min, followed by blocking in PBS containing 5% BSA for 30 min. The primary antibody was incubated overnight at 4 °C, followed by the secondary antibody for 30 min at room temperature, blocked with DAPI for 3 min. Fluorescent images were observed using a Leica laser scanning spectral confocal microscope (Leica, Germany). Quantitative analysis of cell immunofluorescence signals was conducted using ImageJ software. Initially, the experimental images were imported into ImageJ and converted to 8-bit grayscale images. Subsequently, an appropriate threshold was set using the “Threshold” function within the “Adjust” submenu under the “Image” menu, ensuring clear differentiation between the cells and the background in the pop-up threshold settings dialog box. Following this, the “Set Measurements” option was selected, and parameters such as “Mean Gray Value” were chosen in the subsequent dialog box. Ultimately, the quantitative assessment of cellular immunofluorescence intensity was accomplished through the “Measure” option in the “Analyze” menu.

Histological and immunohistochemical analysis

Tissues were carefully collected and promptly fixed using 4% formaldehyde, followed by embedding in paraffin. For antigen retrieval, we employed citric acid, a mild acidic buffer. Under precisely controlled temperature and time conditions, citric acid effectively breaks the cross-linked chemical bonds via hydrolysis. This crucial process re-exposes the previously masked antigen determinants, allowing them to regain their full capacity to bind with corresponding antibodies. The tissues were sliced and stained with hematoxylin, eosin (H&E), or P65 antibody at a 1:50 dilution for IHC analysis. We employed ImageJ software to select and quantitatively analyze IHC staining regions. Initially, the experimental images were imported into ImageJ software. Subsequently, within the software, the “Color deconvolution” function located in the “Color” sub-menu under the “Image” menu was utilized to isolate the immunohistochemical staining area from the background. Following this, the “Threshold” function in the “Adjust” sub-menu under the “Image” menu was activated. In the pop-up threshold-setting dialog box, an appropriate threshold was set. Finally, the quantitative analysis of the immunohistochemistry-stained area was accomplished by selecting the “Measure” option in the “Analyze” menu.

Statistical analysis

Experimental data are presented as mean ± standard deviation. Normality was assessed using the Anderson-Darling tests. Post-hoc and multiple comparison tests were applied for further analysis. A one-way analysis of variance was utilized to evaluate the statistical significance of differences among groups.

Results

Cytotoxic analysis

To determine the safety effect of sesamoside, we treated Raw264.7 cells with a dose-response of sesamoside at 0, 25, 50, 100, 200, and 500 µM for 12 h, the cell viability was performed by CCK-8 assay. As shown in Fig. 1A and B, sesamoside had almost no cytotoxicity within a concentration of 200 µM, with an IC₅₀ value of 246.4 µM. Then, we examined the apoptosis induced by sesamoside; the flow cytometry results in Fig. 1B showed that 500 µM sesamoside caused apoptosis at 31.61%; however, within 200 µM, sesamoside hardly caused apoptosis. These results show that sesamoside has no cytotoxicity within 200 µM. Therefore, we select this dose range for the subsequent experimental analysis.

Fig. 1

Raw264.7 cells were treated with 0, 25, 50, 100, 200, 500 µM sesamoside for 12 h. (A) Cell viability assay was determined using the CCK-8 assay. (B) The transform of calculation of IC₅₀. (C) Apoptosis assay was determined by flow cytometry. ^***P < 0.001 vs. control group, NS, not significant

Sesamoside blocks LPS-induced inflammation cytokines transcription

The homeostasis of the inflammatory environment is considered the most critical factor in the pathogenesis of septic shock. The body recognizes pathogens and binds to their receptors, leading to abnormal activation of signal cascades and promoting the secretion of many inflammatory factors, TNF-α, IL-6, IL-1β, iNOS, and NO. The spleen and liver, as immune organs, provide an immune environment that can respond to dangerous signals, such as pathogens and bacteria, during septic shock. Here, we investigated the effect of sesamoside on LPS-induced cytokines production. As Fig. 2 shows, LPS stimulation for 12 h increased the transcription of TNF-α, IL-6, IL-1β, and iNOS. However, these effects were blocked by the subsequent addition of 25-, 50-, 100-, or 200 µM sesamoside (Fig. 2A). At the same time, 200 µM sesamoside showed the best effect, and we conducted subsequent experiments with a concentration of 200 µM. Similarly, the Fig. 2B and C showed that the 200 µM sesamoside were added for 6, 12, or 24 h after LPS stimulation, significantly inhibited the mRNA transcription of TNF-α, IL-6, IL-1β, and iNOS, and reduced the production of NO.

Fig. 2

(A) Raw264.7 cells were stimulated with 1 µg/mL LPS for 12 h, then treated with 1 µM DEX or 25, 50, 100, or 200 µM sesamoside for 6 h, the mRNA transcription of TNF-α, IL-6, IL-1β, and iNOS were determined by qPCR. (B) Raw264.7 cells were stimulated with 1 µg/mL LPS for 12 h, then treated with 1 µM DEX or 200 µM sesamoside for 6-, 12-, and 24 h, the mRNA transcription of TNF-α, IL-6, IL-1β, and iNOS were determined by qPCR. (C) The cell supernatants of (B) were collected, and NO production was measured. ^###P < 0.001 vs. control group. ^*P < 0.05, ^**P < 0.01 and ^***P < 0.001 vs. model group, NS, not significant

Sesamoside inhibits the NF-κB/MAPK signaling pathway induced by LPS

The NF-κB/MAPK signaling pathway is vital in the immune response to septic shock infection. It acts with the inflammatory factors iNOS, NO, TNF-α, IL-6, IL-1β, and LPS to influence the disease progression in septic shock. To explore the role of sesamoside in septic shock infection, we took immunoblotting to detect the protein expression of P-ERK, P-JNK, and NLRP3. As Fig. 3 shows, the LPS significantly upregulated the relative protein expression, contributing to the aberrant activation of NF-κB/MAPK. Sesamoside treatment inhibited the LPS-induced phosphorylation of ERK and JNK and downregulated the expression of NLRP3, reducing the inflammatory response.

Fig. 3

Raw264.7 cells were stimulated with 1 µg/mL LPS for 12 h, then treated with 1 µM DEX or 200 µM sesamoside for 6-, 12-, 24 h. (A) The protein expression of P-ERK, ERK, P-JNK, JNK, and NLRP3 were detected using western blots. (B) The statistical analysis of (A). ^###P < 0.001 vs. control group. ^***P < 0.001 vs. model group, NS, not significant

Sesamoside restricts the nuclear localization of P65

NF-κB is widely present in cells and regulates inflammatory and immune responses. P65 plays a critical role in NF-κB activation and is usually induced by LPS and inflammatory factors to exhibit nuclear translocation to upregulate inflammation. We detected the effect of sesamoside by immunofluorescence staining to determine whether it could affect the nuclear translocation of P65. The results showed that 200 µM sesamoside restricted the transport of P65 into the nucleus in a time-dependent manner (Fig. 4).

Fig. 4

Raw264.7 cells were stimulated with 1 µg/mL LPS for 12 h, then treated with 1 µM DEX or 200 µM sesamoside for 6-, 12-, 24 h. (A) Immunofluorescence staining for P65 and the nucleus was performed. Scale bars, 75 μm. (B) The quantitative values of immunofluorescence images. ^###P < 0.001 vs. control group. ^***P < 0.001 vs. model group

Sesamoside ameliorates multi-organ damages in LPS-induced septic shock

Mice were randomly divided into six groups: (1) control group with PBS, (2) model group with 10 mg/kg body weight LPS, (3) 10 mg/kg body weight LPS + 10 mg/kg body weight DEX, (4) 10 mg/kg body weight LPS + 1 mg/kg body weight sesamoside, (5) 10 mg/kg body weight LPS + 5 mg/kg body weight sesamoside, (6) 10 mg/kg body weight LPS + 10 mg/kg body weight sesamoside. Mice were intraperitoneally injected with LPS for 12 h, followed by DEX or sesamoside with a concentration gradient for 6 h. At the end of the experiment, mice were sacrificed by cervical dislocation. As shown in Table 1, the mice in the LPS group showed an increase in white blood cells, lymphocytes, and monocytes; increased heart rate and respiratory rate; secretions appearing in the corners of the eyes; urine incontinence, listlessness, lethargy, and curled up with hair erect, indicating that the model was successful.

The overall morphology of the tissue showed that all tissues have normal morphology and no congestion in the control group. The lungs were dry and light red; the spleen tissue was dark red, soft, and brittle; the heart tissue was without infarcted areas; the renal tissue was a full shape and had no edema; the liver tissue was intact in size and appeared light red. However, in the LPS model group, lung tissue sclerosis and apparent congestion and bruising were observed; spleen tissue was significantly congested, and the color became darker; the heart tissue was dark red with apparent congestion; the renal tissue had darker color and bleeding foci; and the liver tissue appeared dark red. The above phenomena were significantly alleviated in the sesamoside treatment groups (Fig. 5A).

H&E staining was carried out to observe the protective effects of sesamoside on LPS-induced multiple organ damage. Figure 5B shows that mouse alveolar and spleen structures are normal; myocardial cells’ morphology, size, and arrangement are normal, and inflammatory cells are not infiltrated. The arrangement of renal glomeruli in renal tissue is regular, with no swelling of endothelial cells, no infiltration of inflammatory cells in blood vessels, regular arrangement of liver cells, normal morphology, and no signs of edema in the cytoplasm and interstitial space. Compared with the control group, after intraperitoneal injection of LPS, the size of the mouse alveolar cavity varied, accompanied by bleeding lesions, and there was significant edema, bleeding, and inflammatory cell infiltration in the lung interstitium; disordered structure of spleen and white bone marrow, blurred, congested, and swollen border between red and white bone marrow; bleeding of cardiac tissue, infiltration of inflammatory cells, and disorder of myocardial cells presenting fibrous morphology; significant renal interstitial edema and inflammatory cell infiltration can be observed in the renal tissue; and the structure of liver lobules is severely damaged. Compared with the model group, sesamoside treatment, to some extent, alleviated the multi-organ damage caused by LPS.

Table 1 The inflammatory cells induced by LPS in vivo

Fig. 5

Mice were intraperitoneally injected with LPS for 12 h, followed by DEX or sesamoside with a concentration gradient for 6 h. (A) Images of different groups of heart, liver, spleen, lung, and kidney organs. (B) Representative morphological images by H&E staining (200x) were presented to assess the injury of organ injury. Scale bar: 200 px

Sesamoside reduces the expression of the pro-inflammatory cytokines in LPS-induced septic shock

The in vitro results of Raw264.7 cells indicated that sesamoside treatment inhibited the LPS-induced inflammation cytokines TNF-α, IL-6, IL-1β, iNOS, and NO production. Therefore, we detected the anti-inflammatory effects of sesamoside in LPS-induced septic shock mice spleen tissue. The transcription level of TNF-α, IL-6, IL-1β, and iNOS was detected by qPCR, and the results in Fig. 6A indicated that sesamoside significantly reduced the expression of the pro-inflammatory cytokines in LPS-induced septic shock and was in a dose-dependent manner.

As sesamoside reduced LPS-induced inflammatory responses, immediately after that, we investigated the protein expression of the NF-κB/MAPK signaling pathway. Western blot results in Fig. 6B and C showed that sesamoside inhibited the phosphorylation of ERK and JNK and decreased the expression of P65 and NLRP3 in spleen tissue. Based on our in vitro results, which showed that sesamoside inhibits the transcription of P65 into the nucleus, IHC staining was used to detect the effect of sesamoside on P65 expression at the in vivo level. The results in Fig. 6D and E revealed that after LPS injection, the P65 expression was abnormally active in multi-tissue; however, intraperitoneal injection of different doses of sesamoside could significantly inhibit the activation of P65. Together with the expression results of inflammatory factors mentioned in Fig. 6A and B, it was confirmed that sesamoside improved the inflammatory level, thereby preventing organ dysfunction in septic shock mice.

Fig. 6

Mice were intraperitoneally injected with LPS for 12 h, followed by DEX or sesamoside with a concentration gradient for 6 h. (A) The mRNA transcription of TNF-α, IL-6, IL-1β, and iNOS were determined by qPCR. (B) The protein expression of P-ERK, ERK, P-JNK, JNK, and NLRP3 was detected by western blots. (C) The statistical analysis of (B). (D) Representative morphological images by IHC staining (200x) were presented to assess the expression of P65. (E) The quantitative values of P65 in IHC. ^#P < 0.05 and ^###P < 0.001 vs. control group, NS, not significant. ^*P < 0.05, ^**P < 0.01 and ^***P < 0.001 vs. model group, NS, not significant

Discussion

The management of sepsis is one of the primary challenges faced by emergency physicians. Sepsis is a life-threatening organ dysfunction that is caused by the host’s imbalance in response to infection. Septic shock is a subtype of sepsis, and abnormal circulation, cells, and metabolism are the reasons for the increase in mortality [17]. Studies show that the risk of death of patients who survive discharge after sepsis is increasing over time; those who survive usually have impaired physical or neurocognitive function, emotional disorders, and low quality of life [18]. Our study demonstrated the efficacy of sesamoside in mitigating the inflammatory response in LPS-induced septic shock.

Generally speaking, the pro-inflammatory reaction is considered the cause of collateral tissue damage in severe sepsis. In contrast, the anti-inflammatory response is associated with an increased susceptibility to secondary infection. Sepsis is characterized by excessive inflammation [3]. As important signal molecules of the immune response, excessive production of iNOS and NO will lead to microcirculation disturbance, inability to provide enough oxygen and nutrition for cells and tissues and shock [19]. Markers of inflammatory factors, such as TNF-α, IL-6, and IL-1β, can be used as accurate predictors of endotoxin diagnosis in shock patients. The infiltration of these factors in immune cells participates in the polarization reaction of macrophages, leading to the amplification of inflammatory cascade reactions in the body, which is extremely important in the mechanism of septic shock [20]. Our in vitro and in vivo experiments demonstrated that sesamoside effectively curbed the transcription of these inflammatory factors. In Raw264.7 cells and septic shock mouse models, sesamoside treatment significantly reduced the production of TNF-α, IL-6, IL-1β, iNOS, and NO, indicating its potent anti-inflammatory properties.

LPS stimulates M1-type polarization of macrophages and produces various inflammatory mediators, among which MAPK and NF-κB signaling pathways play a vital role [21]. MAPK can transfer the macrophage’s recognition of pathogen risk factors to its nucleus, and JNKs can also be released in the nucleus. JNK is an essential upstream component of NF-κB, which participates in the immune system’s response to inflammatory reactions and plays a regulatory role [22]. P65 is the core of NF-κB heterodimer, which is transferred from cytoplasm to nucleus, releasing it in IκB-α [23]. Phosphorylation and degradation of κB kinase are critical in the NF-κB pathway and stimulate pro-inflammatory factors’ production [21]. Our western blot and immunofluorescence results showed that sesamoside inhibited the phosphorylation of ERK and JNK and downregulated NLRP3 expression. Moreover, it restricted the nuclear localization of P65, a key component of NF-κB, thereby blocking the transcriptional activation of pro-inflammatory genes. This finding suggests that sesamoside intervenes in the LPS-induced inflammatory cascade by modulating the NF-κB/MAPK signaling pathway, effectively weakening the inflammatory response in the studied organs.

Although the mechanism of organ failure in sepsis is only partially clarified, inflammation can cause vascular endothelial dysfunction, cell death, and loss of barrier integrity, resulting in subcutaneous and body cavity edema. The protective effects of sesamoside were further evident in histological analyses, which alleviated multi-organ damage caused by LPS. This effect was accompanied by a decrease in the infiltration of inflammatory cells and an improvement in organ structure and function. These findings suggest that sesamoside reduces inflammation and has a direct protective effect on organ tissues.

The treatment of septic shock includes cardiopulmonary resuscitation and alleviating the direct threat of uncontrolled infection. Resuscitation requires intravenous infusion and vasopressor, and oxygen therapy and mechanical ventilation are provided when necessary. Antibiotic therapy includes single-drug antibiotic therapy and combined antibacterial therapy [24, 25]. Regarding the molecular activity of sesamoside, its ability to inhibit the phosphorylation of ERK and JNK and downregulate the expression of NLRP3 and P65 provides insight into its mechanism of action. However, further studies are needed to elucidate the underlying molecular mechanisms and signaling. These studies could include more detailed proteomics and metabolomics analyses to identify additional targets and pathways affected by sesamoside. To confirm sesamoside’s potential as a therapeutic candidate for septic shock, several avenues of research can be pursued. First, more extensive animal studies are necessary to validate the efficacy and safety of sesamoside in more complex models of septic shock. Second, clinical trials in humans are essential to translate these preclinical findings into clinical practice. Such trials would require careful patient selection, drug delivery strategies, and outcome measurements to ensure the precision and effectiveness of the medical strategy. Additionally, given the unique advantages of Tibetan medicine in modern medicine, further exploration of sesamoside’s potential in other inflammatory and immune-related diseases may be warranted. The anti-inflammatory, antibacterial, analgesic, antitussive, expectorant, and antiasthmatic properties of sesamoside suggest its broad applicability in various therapeutic areas.

In conclusion, our study provides compelling evidence for the therapeutic potential of sesamoside in septic shock. Sesamoside offers a new pharmacological basis and drug selection for treating this life-threatening condition by inhibiting the inflammatory response and protecting organ tissues. Future research should focus on elucidating the underlying molecular mechanisms and conducting larger animal and human studies to confirm these findings and explore additional therapeutic applications of sesamoside.